circad | circRNAs associated with diseases

hsa_circ_0016760
Gene	SNAP47	Organism	Human
Genome Locus	chr1:227935392-227947186:+	Build	hg19
Disease	Non small cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	29440731
Experimental Method
Sample Type	Tissues	Comparison	46 Non small cell Lung Cancer (NSCLC) tissues and corresponding 46 adjacent tissues
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGCATTGGTGCTCAGAAGCG Reverse TCTGTTCCTGGGTCTGTGTGC	Statistics	Fold Change : Upregulated,4.36 pvalue : p=0.02712
Citation
Zhang, S, Zeng, X, Ding, T, Guo, L, Li, Y, Ou, S, Yuan, H (2018). Microarray profile of circular RNAs identifies hsa_circ_0014130 as a new circular RNA biomarker in non-small cell lung cancer. Sci Rep, 8, 1:2878.